Wolfram Computation Meets Knowledge

Leveling Up in Life Sciences: Unleashing the Power of Computational Biology with Wolfram Language

Leveling Up in Life Sciences: Unleashing the Power of Computational Biology with Wolfram Language

In days past, life sciences was reserved for those who had access to the proper equipment to observe and experiment with the organisms of the physical world. For today’s scientist, exploration doesn’t end with access to physical encounters. Whether you’re classifying an animal for the first time or using a protein visualizer to develop medication, Wolfram Language holds the tools and power to support your computational life science endeavors. The following is a collection of biology resources, projects and functions in Wolfram Language for any skill level.

Level 1—Learn about Computational Biology

The fields of life science cover a lot of ground—understandably so, given how expansive life itself is. Begin your computational biology journey with basic educational tools and virtual experiments.

Science & Technology Q&A for Kids & Others

Stephen Wolfram’s Science & Technology Q&A for Kids & Others is a weekly stream where Wolfram answers questions in hopes of breaking down the complexities of science and technology in an approachable way for those unfamiliar.

Each stream is an impromptu discussion that is not bound to a particular topic, but often finds common themes as the discussions unfold. Episode 120 features an in-depth look into DNA, genetic engineering and neurology. In episode 121, Wolfram looks into synthetic biology and the future of biotechnology. Have a question? You can submit your own questions to be answered in a future stream.

Wolfram|Alpha Example Queries

Wolfram|Alpha’s searchable database gives budding computational scientists the tools to find reliable information and calculations to support just about any field of work—including biology and life sciences. Example queries for biology are available to instantly learn about anatomy, taxonomy and genomics.

Wolfram Demonstrations Project

The Wolfram Demonstrations Project offers more than thirteen thousand interactive Wolfram Language Demonstrations in varying fields, including nearly two hundred biology Demonstrations. Set unique conditions and watch experiments unfold from Demonstrations like the following.

The Cell Cycle
By: Rachel Lian and Stacy Hu

This Demonstration shows a visual model of the phases of mitosis.

Centriole = {

DNA Replication
By: Priyanka Multani

Multani’s Demonstration shows how the DNA helix unwinds and uses the old DNA strand as a template to create two daughter helices.

list = "ATCGTTTGCAACTGCCAATCA"

3D Skeletal Anatomy of the Arm
By: Stewart Dickson

Dickson’s Demonstration offers an interactive skeletal model of the human arm—complete with rotating views and highlighting of different bones for easy identification.

bone1geom =

Predator-Prey Dynamics with Type-Two Functional Response
By: Wilfried Gabriel

Gabriel’s Demonstration uses simplified Lotka–Volterra equations to demonstrate simple predator-prey cycles. You can adjust the model by altering each part of the equation from predator competition to prey death rates.

Manipulate [

Latest Features in Wolfram Language

When you’re ready to start creating your own computational life science experiments, Wolfram Language’s biology functions give you the power to build an interactive stage for exploration and experimentation. The most recent published entities include:

  • "TaxonomicSpecies"—This feature offers detailed information for the taxa of plants, animals, microbes and more.
DeleteMissing, Dataset

  • AnatomicalStructure—This feature offers detailed information for more than ninety thousand human anatomical parts.
Entity[AnatomicalStructure, PrefrontalCortex], Association

Wolfram Function Repository

The Wolfram Function Repository offers an ever-expanding collection of Wolfram Language functions developed by both Wolfram teams and users. With over 2,500 functions available, there are plenty of biology tools to go around for the computational biologist.

  • DNAAlignmentPlot creates a colorful visual for DNA sequences.
  • TaxonomicNearest generates taxa to the nearest taxon.
  • FoodWeb generates graphs displaying predator-prey relationships for a given animal.
  • TaxonomyGraph displays a taxonomy graph for a given species.

Wolfram System Modeler—Bio Chem Library

Wolfram System Modeler is an interactive modeling lab that gives you the chance to run dynamic simulations for varying environments. The Bio Chem library offers modeling, simulation and visualization of biological and biochemical systems. You can learn about how the Bio Chem library is used for safe drug research and development with FDA-approved models.

Insulin analysis models

Level 2—Experiment with Computational Biology

Computational biology in Wolfram Language doesn’t stop with informational entities and projects. The following resources show applications for using Wolfram technologies to complete life science experiments and research.

Wolfram|Alpha Biology Team

The Wolfram|Alpha biology team walks through its more advanced content and features in livestreams, Wolfram Technology Conference talks and blog posts.

Video Walkthroughs

Wolfram Research Blog

Wolfram Function Repository

The Wolfram Function Repository also offers more advanced functions to keep you progressing with your computational biology work, including utilizing the Global Biodiversity Information Facility’s data.

From Pictures of Animals, Try to Reconstruct the Tree of Life (Wolfram High School Summer Research Program 2022)
By: Maya Viswanathan

The Wolfram High School Summer Research Program is an opportunity for high-school students to participate in their own research projects with mentors from the Wolfram team and Stephen Wolfram.

Viswanathan’s research project used Wolfram Language’s image-processing capabilities to make a taxonomical tree of life. The diagrams are used to organize different organisms into different classifications, including taxonomy and evolution. Viswanathan’s diagrams build trees solely off of how Wolfram Language interpreted images of different organisms, resulting in an impressive and colorful display.

Tree of life

Water and Heat Exchanges in Mammalian Lungs
By: Benoit Haut

Haut’s project uses a mathematical model that evaluates how varying mammalian lungs use water and heat to self-regulate temperature. Haut spares no effort in creating visually stunning models for easy reading.

Water and heat exchanges in mammalian lungs

Computational Anatomy Visualizations, Animations, Web-Deployment
By: Martijn Froeling

Froeling is an assistant professor specializing in quantitative neuromuscular MRI techniques to better understand muscle functions and diseases. He found himself in a project that required many images of anatomical models of lower-extremity muscles. He decided to use Wolfram Language to generate interactive models to use in his project rather than taking the time to search the web for the exact angles needed.

Computational anatomy visualizations

QMRITools Paclet

In 2023, Froeling was awarded a Wolfram Innovation Award for his paclet QMRITools. This paclet was developed as a toolkit for experimental design, data analysis and teaching. The paclet has been credited as a tool in over 50 scientific papers and currently offers more than 450 functions. QMRITools has helped to simplify quantitative MRI analysis.

Level 3—Research Computational Biology

Wolfram technology is currently being used in a variety of advanced research projects that push the current understanding of life sciences further and further. Combining Wolfram and the life sciences at a higher level offers an affordable and quicker way to test hypotheses and conduct analyses.

Wolfram YouTube Channel

Mathematica in Cell Biology: Image Segmentation and Analysis of 3D Tumor Spheroids
Sabine Fischer discusses the work of the physical biology group at Goethe University Frankfurt in cell biology—particularly its work in image segmentation and assessing tumor spheroids.

Bioinformatics in the Wolfram Language
John Cassel discusses the Wolfram|Alpha Scientific Group’s work on computational bioinformatics in Wolfram Language and different applications to the life sciences.

Mathematical Models in the Biosciences 1
By: Michael Frame

Frame’s Mathematical Models in the Biosciences 1 offers a look into using Wolfram Language to aid in the mathematical foundations of biosciences, including chemotherapy, predator-prey relations, nerve impulses and more.

Mathematical Models in the Biosciences 1

Introducing the Wolfram ProteinVisualization Paclet!
By: Soutick Saha

Saha’s ProteinVisualization paclet is designed to create intricate, colorful, 3D visualizations of biomolecules, including proteins, nucleic acids and their complexes. The paclet also allows for computing elements such as contact maps, graphs and dihedral angles.

Protein visualization

Wolfram Language Paclet Repository

The Wolfram Language Paclet Repository offers additional tools to be used within Wolfram Language. Check out the current available biology paclets to bolster your computational biology work, including CompartmentalModeling and StickyDBSCAN. You can help build the Repository by submitting your own paclets.

Find Your Computational X

Wolfram has always been committed to pushing boundaries in pursuit of the idea of computational X, or the coming together of technology and the rest of the world. The Wolfram Language we know and love today was founded on the basis of supporting Stephen Wolfram’s passion for physics. This idea of pushing boundaries in different fields is carried through by the efforts of Wolfram developers, who strive to make exciting breakthroughs with every new version, and the users, who share their own projects and discoveries.

Looking for more great resources to find your computational X? Check out our collection of courses at Wolfram U and varying events and workshops to learn more about Wolfram Language and its different application areas. If you’re currently working on a project, be sure to share it to Wolfram Community, or contact us for the chance to be featured in an upcoming blog post.

Comments

Join the discussion

!Please enter your comment (at least 5 characters).

!Please enter your name.

!Please enter a valid email address.